Pesquisar

GENÉTICA - DNA E RNA



1) Em que se baseia a primeira lei de Mendel? Quais hipóteses levantadas por Mendel culminaram nessa lei?
“Cada caráter é condicionado por dois genes, um deles proveniente do pai e o outro da mãe. Apenas um dos dois genes é fornecido a cada gameta produzido.”
Hipóteses:
·        Há um par de fatores (genes) determinando a característica: B – alta e b – baixa
·        Um fator é dominante (B) e o outro recessivo (b)
·        Durante a formação dos gametas, os fatores se segregam (se separam)
2) Diferencie genótipo e fenótipo

Genótipo
Refere-se à constituição genética do indivíduo, ou seja, aos genes que ele possui. Estamos nos referindo ao genótipo quando dizemos, por exemplo, que uma planta de ervilha é homozigota dominante (VV) ou heterozigota (Vv) em relação à cor da semente.
Fenótipo
É empregado para designar as características apresentadas por um indivíduo, sejam elas morfológicas, fisiológicas e comportamentais. Também fazem parte do fenótipo características microscópicas e de natureza bioquímica, que necessitam de testes especiais para a sua identificação.

Genótipo: Genes recebidos dos pais e transmitidos para seus descendentes
Fenótipo: Características específicas do caráter analisado. É determinado pelo genótipo.

3) No cruzamento de cães de pelo preto com cães de pelo branco, obteve-se 100% de cães de pelo preto. Tais animais obtidos foram cruzados entre si, obtendo-se 75% de cães pretos e 25% de cães brancos. Sabe-se assim, que a característica preta é dominante em relação a cor branca. Como descobrir que dos 75% de cães pretos existem aqueles que são heterozigotos e aqueles que são homozigotos?
Pode-se realizar o cruzamento desses cães com animais de pelo branco, dessa forma o que são homozigotos dominantes produzirão apenas descendentes pretos, enquanto aqueles que forem heterozigotos podem produzir descendentes de cor branca
4) Fale sucintamente sobre o processo de tradução.
                O RNAm se junta com a subunidade menor do ribossomo no sentido 5’. Este se liga a um sítio especial nesta subunidade. A outra parte ribossomal possui três sítios de ligação denominados E, P e A. Ocorre então a junção das duas subunidades de tal forma que o primeiro códon do RNAm ficará alinhado ao sítio de ligação P da subunidade maior.
            Um RNAt traz o aminoácido metionina atribuído ao códon de iniciação ATUG no RNAm, inicia-se a fase de alongamento do processo de tradução. A fixação do primeiro aminoácido levado pelo RNAt ocorre no sítio A, a seguir ocorre a formação da ligação peptídica entre a metionina e o segundo aminoácido neste mesmo sítio, iniciando futura cadeia polipeptídica a ser formada.
            O ribossomo move-se na direção 3’, para as próximas três bases do RNAm , ou seja, deslocando-se para o seguinte códon. Dessa forma, RNAt e a cadeia polipeptídica deslocam-se para  o sítio P. O sítio fica então aberto e um novo RNAt poderá se acoplar. No sítio E, encontra-se então o antigo RNAt que está vazio, sem aminoácido e que serão então ejetado.
Novos aminoácidos são trazidos, seguindo a mesma sequência de ocupação de sítios do ribossomo até a chegada do  códon de parada no sítio A. Uma proteína fator de liberação se liga ao códon de parada no sito A, indicando a separação da cadeia polipeptídica formada e seguinte separação do maquinaria da tradução: subunidades ribossômicas, fita de RNAm e RNAt. A cadeia polipeptídica pode ir para o citoplasma para posterior processamento.

5) O DNA, conteúdo genômico de um organismo, consiste de uma macromolécula que é formada por unidade menores, ou seja, monômeros. Quem são esses compostos?
Nucleotídios
6) As leis que governam a genética se baseia em probabilidades. Dessa forma, qual a probabilidade de um casal, pais de filhos gêmeos masculinos, terem na próxima gestação uma criança do sexo feminino?
50%.
7) Qual a possibilidade de gametas gerados pelos genótipos abaixo:
a) Bb – B e b
b) BB - B
c) BB - b
8) Fale sobre o dogma central da biologia que explica o fluxo da informação genética.

O Dogma Central da Biologia Molecular explica como ocorre o fluxo de informações genéticas.


9) O que garante a formação da dupla fita da molécula do DNA? Qual a importância desse processo?
O pareamento complementar das bases nitrogenadas, garantindo o processo de hereditariedade e a universalidade do DNA.
10) Caracterize os RNAs envolvidos no processos de síntese de proteínas.
      Os mRNA contem a mensagem que será traduzida em proteína, de sorte que a seqüência de bases no mRNA determina a seqüência dos aminoácidos no polipeptídio.
      Em forma de trevo, como alças, carregando os aminoácidos específicos para cada códon específico.
      O ribosssomo é formado de duas subunidades, sendo que cada uma é formada de um RNAr e várias proteínas pequenas.

11) Defina:
a) gene recessivo - manifesta fenotipicamente o caráter em homozigose
b) gene dominante - Manifesta o mesmo fenótipo, tanto em homozigose (AA) como em heterozigose (Aa)
c) genes alelos - Ocupam o mesmo locus em cromossomos homólogos
d) locus gênico - Lugar definido ocupado pelo gene no cromossomo

12) No fragmento de DNA abaixo, forneça o que se pede. Observação: as partes grifadas correspondem aos íntrons.
5’ – ATGTTACTACCACCGATAATCGGAAGATGA – 3’
a) a fita completar
3’ – TACAATGATGGTGGCTATTAGCCTTCTACT – 5’
b) o pré – RNAm
5’ – AUGUUACUACCACCGAUAAUCGGAAGAUGA – 3’
c) o RNAm funcional
5’ – AUGCUACCACCGAUAAUAAGAUGA – 3’
d) os anti-códons
UAC-GAU-GGU-GGC-UAU-UAU-UCU-ACU
d) os aminoácidos adicionados
metionina – leucina – prolina – prolina – isoleucina – isoleucina – arginina - parada


Nenhum comentário:

Postar um comentário